2. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

DNA sequence

" in MedChemExpress (MCE) Product Catalog:

50

Inhibitors & Agonists

1

Screening Libraries

1

Fluorescent Dye

1

Biochemical Assay Reagents

18

Peptides

2

Natural
Products

1

Antibodies

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-107769
    Duocarmycin TM
    1 Publications Verification

    CBI-TMI

    		 ADC Cytotoxin DNA Alkylator/Crosslinker Antibiotic Cancer
    Duocarmycin TM (CBI-TMI) is a potent antitumor antibiotic. Duocarmycin TM induces a sequence-selective alkylation of duplex DNA.
    Duocarmycin TM
  • HY-N6181
    Terrelumamide A

    		Others Endocrinology
    Terrelumamide A is a lumazine-containing peptide. Terrelumamide A is isolated from the culture broth of the marine-derived fungus Aspergillus terreus. Terrelumamide A exhibits pharmacological activity by improving insulin sensitivity. Terrelumamide A has the potential in the application of DNA sequence recognition .
    Terrelumamide A
  • HY-E70212
    Hhal Methyltransferase

    Hhal

    		DNA Methyltransferase Cancer
    Hhal Methyltransferase (Hhal) is a DNA methyltransferase (recognition sequence: GCGC) .
    Hhal Methyltransferase
  • HY-157001
    7-Deaza-dGTP tetralithium

    		Others Others
    7-Deaza-dGTP tetralithium can be used for amplification of GC-rich DNA sequences .
    7-Deaza-dGTP tetralithium
  • HY-E70209
    EcoRI Methyltransferase

    		DNA Methyltransferase Cancer
    EcoRI Methyltransferase is a bacterial sequence-specific S-adenosyl-L-methionine-dependent DNA methyltransferase. EcoRI Methyltransferase relies on a complex conformational mechanism to achieve its remarkable specificity, including DNA bending, base flipping and intercalation into the DNA .
    EcoRI Methyltransferase
  • HY-P5343
    p53 CBS

    p53 Consensus binding sequence

    		 MDM-2/p53 Others
    p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)
    p53 CBS
  • HY-160226
    ISD Control sodium

    		STING Inflammation/Immunology
    ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD, its double-stranded counterpart .
    ISD Control sodium
  • HY-D1180
    DTTCI

    3,3′-Diethylthiatricarbocyanine iodide

    		 Fluorescent Dye Others
    DTTCI (3,3′-Diethylthiatricarbocyanine iodide) is an infrared photographic sensitizing dye. DTTCI is a highly sensitive chiroptical reporter of DNA helicity and sequence .
    DTTCI
  • HY-101160
    SG2057

    DRG16

    		 DNA Alkylator/Crosslinker ADC Cytotoxin Cancer
    SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of DNA forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .
    SG2057
  • HY-E70214
    MspI Methyltransferase

    MspI

    		DNA Methyltransferase Cancer
    MspI Methyltransferase (MspI), a methyltransferase, recognizes the sequence CCGG and catalyzes the formation of 5-methylcytosine at the fist C-residue. MspI Methyltransferase binds to DNA in a sequence-specific manner either alone or in the presence of the normal methyl donor S-adenosyl-L-methionine as well as the analogues, sinefungin and S-adenosyl-L-homocysteine .
    MspI Methyltransferase
  • HY-147740
    WEHI-150

    		DNA Alkylator/Crosslinker Cancer
    WEHI-150 is a replica of mitoxantrone, is a portent DNA interstrand crosslinksequences and exhibits a preference for methylated CpG sites. Formaldehyde-activated WEHI-150 induces DNA interstrand crosslinks. Formaldehyde-activated WEHI-150 shows Concentration-dependent transcription blockages. WEHI-150 can mediate covalent adducts that are independent of interactions with the N-2 of guanine and is capable of adduct formation at novel DNA sequences .
    WEHI-150
  • HY-155869A
    5-fluoro-dCTP sodium

    5-Fluoro-2′-deoxycytidine 5′-triphosphate sodium

    		 Others Others
    5-fluoro-dCTP sodium is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP sodium
  • HY-155869
    5-fluoro-dCTP

    5-Fluoro-2′-deoxycytidine 5′-triphosphate

    		 Others Others
    5-fluoro-dCTP is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP
  • HY-153916
    TCRS-417

    T417

    		 Others Neurological Disease Inflammation/Immunology Cancer
    TCRS-417 (T417) is a small molecule compound capable of docking to the interface between PBX1 and its cognate DNA target sequence, effectively interfering with PBX1-DNA interaction. TCRS-417 can be used in the research of cancer, developmental disorders, inflammatory disorders, autoimmune diseases or neurodegenerative diseases .
    TCRS-417
  • HY-112951
    ChX710
    2 Publications Verification

    		 STING Cancer
    ChX710 could prime the type I interferon response to cytosolic DNA, which induces the ISRE promoter sequence, specific cellular Interferon-Stimulated Genes (ISGs), and the phosphorylation of Interferon Regulatory Factor (IRF) 3.
    ChX710
  • HY-12455
    Duocarmycin A

    		ADC Cytotoxin Apoptosis Caspase Cancer
    Duocarmycin A, which is one of well-known antitumor antibiotics, is a DNA alkylator and efficiently alkylates adenine N3 at the 3′ end of AT-rich sequences in the DNA. Duocarmycin A, as a chemotherapeutic agent, results HLC-2 cells typically apoptotic changes, including chromatin condensation, sub-G1 accumulation in DNA histogram pattern, and decrease in procaspase-3 and 9 levels .
    Duocarmycin A
  • HY-160728
    3′-O-N3-dATP

    3′-O-Azidomethyl dATP

    		 Biochemical Assay Reagents Others
    3′-O-N3-dATP (3′-O-Azidomethyl dATP) is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP
  • HY-153494
    Rosomidnar

    PNT100

    		 Bcl-2 Family Cancer
    PNT100 is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
    Rosomidnar
  • HY-153494A
    Rosomidnar sodium

    PNT100 sodium

    		 Bcl-2 Family Cancer
    PNT100 sodium is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
    Rosomidnar sodium
  • HY-150729
    ODN 1982

    		Others Inflammation/Immunology
    ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
    ODN 1982
  • HY-W040129
    Chromomycin A3

    		Bacterial Fungal Apoptosis Antibiotic Infection Cancer
    Chromomycin A3 is an aureolic acid-type antitumor antibiotic. Chromomycin A3 forms dimeric complexes with divalent cations, such as Mg 2+, which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. Chromomycin A3 has a variety of utilities as a staining agent for human sperm chromatin, autophagy inducing agent, and apoptosis inhibitor .
    Chromomycin A3
  • HY-100758
    FUBP1-IN-1

    		Others Cancer
    FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC50 value of 11.0 μM .
    FUBP1-IN-1
  • HY-P1310
    VKGILS-NH2
    1 Publications Verification

    		 Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 has no effect on DNA synthesis in cells .
    VKGILS-NH2
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-P1310A
    VKGILS-NH2 TFA

    		Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 TFA is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 TFA has no effect on DNA synthesis in cells .
    VKGILS-NH2 TFA
  • HY-400705
    Duocarmycin SA intermediate-1

    		Others Cancer
    Duocarmycin SA intermediate-1 is an intermediate in the synthesis of the antibiotic Duocarmycin SA (HY-12456). Duocarmycin SA intermediate-1 induces sequence-selective alkylation of double-stranded DNA and has synergistic, tumor-suppressive cytotoxicity with proton irradiation .
    Duocarmycin SA intermediate-1
  • HY-400706
    Duocarmycin SA intermediate-2

    		Others Cancer
    Duocarmycin SA intermediate-2 is an intermediate in the synthesis of the antibiotic Duocarmycin SA (HY-12456). Duocarmycin SA intermediate-2 induces sequence-selective alkylation of double-stranded DNA and has synergistic, tumor suppressor cytotoxicity with proton irradiation .
    Duocarmycin SA intermediate-2
  • HY-148424
    PBD dimer-2

    		ADC Cytotoxin Cancer
    PBD dimer-2 (compound 2c) is a C8-linked pyrrolobenzodiazepine dimer. PBD dimer-2 can span an extra base pair and cross-link the 5′-Pu-GA(T/A)TC-Py sequence. PBD dimer-2 can be used as a payload for antibody–agent conjugates (ADCs), and it can be used for the research of cancer .
    PBD dimer-2
  • HY-150214
    ODN MT01

    		Others Cancer
    ODN MT01 was designed based on human mitochondrial DNA sequences, which is an inhibitory ODN that promotes osteocyte differentiation. ODN MT01 could promote osteoblast maturation and activation in rats, reduce rat alveolar bone absorption caused by periodontitis, regulate the expression levels of osteogenesis-related factors.
    ODN MT01
  • HY-150214A
    ODN MT 01 sodium

    		Others Cancer
    ODN MT01 sodium was designed based on human mitochondrial DNA sequences, which is an inhibitory ODN that promotes osteocyte differentiation. ODN MT01 sodium could promote osteoblast maturation and activation in rats, reduce rat alveolar bone absorption caused by periodontitis, regulate the expression levels of osteogenesis-related factors.
    ODN MT 01 sodium
  • HY-12456
    Duocarmycin SA

    		Antibiotic ADC Cytotoxin DNA Alkylator/Crosslinker Necroptosis Apoptosis Cancer
    Duocarmycin SA is an orally active antitumor antibiotic with an IC50 of 10 pM . Duocarmycin SA is an extremely potent cytotoxic agent capable of inducing a sequence-selective alkylation of duplex DNA. Duocarmycin SA demonstrates synergistic cytotoxicity against glioblastoma multiforme (GBM) cells treated with proton radiation in vitro .
    Duocarmycin SA
  • HY-13642
    RG108
    Maximum Cited Publications
    8 Publications Verification

    N-Phthalyl-L-tryptophan

    		 DNA Methyltransferase Cancer
    RG108 (N-Phthalyl-L-tryptophan) is a non-nucleoside DNA methyltransferases (DNMTs) inhibitor (IC50=115 nM) that blocks the DNMTs active site. RG108 (N-Phthalyl-L-tryptophan) causes demethylation and reactivation of tumor suppressor genes, but it does not affect the methylation of centromeric satellite sequences .
    RG108
  • HY-E70090
    T7 RNA polymerase

    		DNA/RNA Synthesis Others
    T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
    T7 RNA polymerase
  • HY-W010970
    5'-Guanylic acid disodium salt
    1 Publications Verification

    5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt

    		 Endogenous Metabolite Others
    5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .
    5'-Guanylic acid disodium salt
  • HY-135900
    Aniline-MPB-amino-C3-PBD

    		ADC Cytotoxin Bacterial Cancer
    Aniline-MPB-amino-C3-PBD is a cytotoxic agent comprised non-alkylating group. Aniline-MPB-amino-C3-PBD is a sequence-selective DNA minor-groove binding agent. Aniline-MPB-amino-C3-PBD acts as the payload for ADCs. Antimicrobial activity .
    Aniline-MPB-amino-C3-PBD
  • HY-P1286
    PKC β pseudosubstrate

    		PKC Neurological Disease
    PKC β pseudosubstrate is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate
  • HY-P1286A
    PKC β pseudosubstrate TFA

    		PKC Neurological Disease
    PKC β pseudosubstrate TFA is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate TFA
  • HY-W406070
    2'-O,4'-C-Methyleneguanosine

    LNA-G

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Others
    2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analogue, where LNA (locked nucleic acid) is a nucleic acid analogue. LNA modification can be used in a variety of applications such as effective binding affinity to complementary sequences and greater nuclease resistance than natural nucleotides, offering great potential for applications in disease diagnosis and research. LNA-G is also available via KOD DNA polymerase, which allows the integration of LNA-G nucleotides into the DNA strand .
    2'-O,4'-C-Methyleneguanosine
  • HY-160728A
    3′-O-N3-dATP trisodium

    3′-O-Azidomethyl dATP trisodium

    		 Biochemical Assay Reagents Others
    3′-O-N3-dATP trisodium (3′-O-Azidomethyl dATP trisodium) is the trisodium salt form of 3′-O-N3-dATP. 3′-O-N3-dATP trisodium is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP trisodium acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP trisodium
  • HY-107767
    Antibiotic DC 81

    DC 81

    		 Antibiotic Apoptosis DNA/RNA Synthesis Cancer
    Antibiotic DC 81 (DC 81), an antitumor antibiotic produced by Streptomyces species, is a PBD (pyrrolo[2,1-c][1,4]benzodiazepine). Antibiotic DC 81 is potent inhibitor of nucleic acid synthesis. Antibiotic DC 81 can recognize and bind to specific sequences of DNA and form a labile covalent adduct .
    Antibiotic DC 81
  • HY-150751
    ODN TTAGGG

    ODN A151

    		 Toll-like Receptor (TLR) AIM2 Inflammation/Immunology
    ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
    ODN TTAGGG
  • HY-106262
    Delcasertib

    KAI-9803; BMS-875944

    		 PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib
  • HY-106262B
    Delcasertib hydrochloride
    1 Publications Verification

    KAI-9803 hydrochloride; BMS-875944 hydrochloride

    		 PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) hydrochloride is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) hydrochloride could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib hydrochloride
  • HY-N2187
    Deoxyshikonin
    1 Publications Verification
    Deoxyshikonin increases the expression of VEGF-C and VEGF-A mRNA in HMVEC-dLy, promotes HIF-1α and HIF-1β subunit interaction and binds to specific DNA sequences targeted by HIF. Deoxyshikonin inhibited colorectal cancer (CRC) through the PI3K/Akt/mTOR pathway. Deoxyshikonin has proangiogenesis effect and antitumor activity. Deoxyshikonin is an antibacterial agent against methicillin-resistant S. aureus (MRSA) and S. pneumonia (MIC=17 μg/mL) .
    Deoxyshikonin
  • HY-P1103A
    CTCE-9908 TFA

    		CXCR Cancer
    CTCE-9908 TFA is a potent and selective CXCR4 antagonist. CTCE-9908 TFA induces mitotic catastrophe, cytotoxicity and inhibits migration in CXCR4-expressing ovarian cancer cells .
    CTCE-9908 TFA
  • HY-P1103
    CTCE-9908

    		CXCR Cancer
    CTCE-9908 is a potent and selective CXCR4 antagonist. CTCE-9908 induces mitotic catastrophe, cytotoxicity and inhibits migration in CXCR4-expressing ovarian cancer cells .
    CTCE-9908
  • HY-122578
    P53R3

    		MDM-2/p53 Cancer
    P53R3 is a potent p53 reactivator and restores sequence-specific DNA binding of p53 hot spot mutants, including p53 R175H, p53 R248W and p53 R273H. P53R3 induces p53-dependent antiproliferative effects with much higher specificity than PRIMA-1. P53R3 enhances the recruitment of wild-type p53 and p53 M237I to several target gene promoters. P53R3 strongly enhances the mRNA, total protein and cell surface expression of the death receptor death receptor 5 (DR5). P53R3 is used for cancer research .
    P53R3
  • HY-P1321
    GR231118

    1229U91; GW1229

    		 Neuropeptide Y Receptor Neurological Disease
    GR231118, an analogue of the C-terminus of neuropeptide Y, is a potent , competitive and relative seletive antagonist at human neuropeptide Y Y receptor with a pKi of 10.4. GR231118 a potent agonist at the human neuropeptide Y Y4 receptor (pEC50=8.6; pKi=9.6) and a weak agonist at the human and rat neuropeptide YY2 and Y5 receptors. GR231118 also has high affinity for the mouse neuropeptide Y Y6 receptor (pKi= 8.8) .
    GR231118
  • HY-P1321A
    GR231118 TFA

    1229U91 TFA; GW1229 TFA

    		 Neuropeptide Y Receptor Neurological Disease
    GR231118 TFA, an analogue of the C-terminus of neuropeptide Y, is a potent , competitive and relative seletive antagonist at human neuropeptide YY receptor with a pKi of 10.4. GR231118 a potent agonist at the human neuropeptide YY4 receptor (pEC50=8.6; pKi=9.6) and a weak agonist at the human and rat neuropeptide Y Y2 and Y5 receptors. GR231118 also has high affinity for the mouse neuropeptide YY6 receptor (pKi= 8.8) .
    GR231118 TFA

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: